Miniproject 3: Read Quality Control

Author

Ryan M. Moore, PhD

Published

April 30, 2025

Modified

August 16, 2026

Note: To complete the miniproject, you will need the material contained in the Read QC project files directory. There, you will find a project scaffold that includes reads, lib.py, and quarto documents to help get you started. The page you are currently reading is the same as miniproject_3_instructions.qmd in the previously linked directory.

Overview

For your final miniproject, you’ll perform quality control analysis on next-generation sequencing (NGS) reads. This is a common first step in any (meta)genomics or RNA-seq pipeline. You’ll gain experience working with FASTQ files, calculating quality metrics, and filtering reads based on quality thresholds.

The provided sequencing data comes from a hypothetical, multi-hospital RNA-seq study with different batches of samples and experimental conditions. Your task is to analyze this data to identify trends in read quality and to filter low-quality reads.

Note: This is the final project, so it will be a bit of a jump in complexity! The instruction document has a ton of info to help you out, and the book chapters and assignment 3 will also be helpful. Be sure to refer to them if you get stuck!

Learning Objectives

By completing this miniproject, you will:

  • Work with sequencing data in FASTQ format
  • Parse and manipulate gzip-compressed files
  • Calculate quality metrics for sequencing reads
  • Visualize quality distributions by different variables
  • Implement a read filtering strategy
  • Practice modular Python programming

Data Info

Input Files

  • FASTQ Files
    • Located in the reads/ directory.
    • These files contain raw sequencing reads with the naming pattern [LOCATION]_[CONDITION][NUMBER].fq.gz.
  • Metadata
    • A tab-separated file metadata.tsv containing sample information.
    • Fields
      • SampleID: Unique identifier for each sample, including a prefix indicating the location (e.g., CHR for Christiana Hospital) and a suffix indicating the condition (C for Control, T for Treatment) with a number.
      • PatientID: Alphanumeric identifier for each patient (e.g., 0626, 5542, 26ED).
      • Batch: Batch designation, either A or B, which groups samples processed and sequenced together.
      • Location: Healthcare facility where the sample was collected (Christiana Hospital, Nemours Children’s Hospital, Jefferson Hospital, or Bayhealth Medical Center).
      • Condition: Experimental condition of the sample, either “Control” or “Treatment”.

FASTQ Format Reminder

Each read in a FASTQ file consists of four lines:

  1. Read identifier (starts with @)
  2. Nucleotide sequence
  3. + (sometimes followed by the identifier again, or other info)
  4. Phred quality scores (encoded as ASCII characters)

See parsing FASTQ files and the processing FASTQ files example from Ch. 9 for more info.

Project Structure

You have been provided a zipped directory with the following structure:

miniproject_3/
├── lib.py
├── metadata.tsv
├── miniproject_3_instructions.qmd
├── miniproject_3_solution.qmd
└── reads
    ├── BAY_C1.fq.gz
    ├── BAY_C2.fq.gz
    ├── ... (more read files)

For this project, you’ll be working with multiple files:

  • miniproject_3_solution.qmd: The main Quarto document where you’ll perform your analysis and write up your results
  • lib.py: A Python module containing helper functions that you will write.
    • The functions and other stuff you need to include in this file will be described in below.
    • All of these functions should have docstrings in the format we described in Ch. 4.

Your Tasks

This miniproject consists of three parts: two required, one optional.

Set Up

You will need the following set up code near the top of your Quarto document.

import gzip
from pathlib import Path

import numpy as np
import pandas as pd
import seaborn as sns
import statsmodels.api as sm
from Bio import SeqIO
from statsmodels.formula.api import ols

# This is our module defined in lib.py
import lib

pd.set_option("display.max_rows", 6)

Additionally, when you need to edit your lib.py file, you will have to manually reload the module. (Or restart the Quarto interactive prompt.) Here is how you can do that:

import importlib
importlib.reload(lib)

Note: I have already included the above code blocks in the solution file for you!

Part 1: Basic Read Quality Analysis (Required)

In this section, you’ll parse the FASTQ files, calculate quality metrics for all samples, and analyze how these metrics vary across different experimental factors.

Part 1A: Parse FASTQ Files

Here are the steps you will need to take. I’ve written it in a sort of pseudocode (:= means assign to a variable, and # are comments) that you can use to help you structure your own code:

# Find all the FASTQ files in the reads directory that match our pattern
# This uses Path.glob() to get files with names ending in _T1.fq.gz, _T2.fq.gz, etc.
paths := get the FASTQ file paths

# Create an empty list to store our processed read information
# Each element will be a ReadInfo object with metadata about a sequence read
reads := empty list

# Process each FASTQ file
for each path in paths
    # Extract the sample name from the filename
    # This helps us track which experiment/condition each read came from
    sample_id := get the sample ID from the path

    # Open and read the compressed FASTQ file
    # Note: gzipped files require special handling with gzip.open()
    # We need to open in text mode ("rt") for Bio.SeqIO to parse correctly
    open the gzipped file for text-reading:
        # Parse each sequence record in the FASTQ file
        # SeqIO.parse creates an iterator of SeqRecord objects
        for each record in the parsed FASTQ file:
            # Create a structured ReadInfo object with metrics we care about
            # We calculate quality score and GC content for each read
            read_info := create a ReadInfo object from the sample and record

            # Add this processed Read to our collection
            append read_info to reads list

# Convert our list of ReadInfo objects to a pandas DataFrame for analysis
# Sort the data by sample ID for easier comparison between samples
# Reset the index to have clean, sequential row numbers
read_data := create a pandas data frame from the reads list,
             sort values by SampleID,
             reset the index
Details & Hints

This subsection has quite a few parts! Here are some hints to help you get started.

Get All FASTQ File Paths

Try the pathlib.Path class to get all the FASTQ file paths:

# Get all FASTQ files in the "reads" directory matching a pattern
paths = Path("reads").glob("*_[TC][123].fq.gz")

# Now you can loop over all the matching paths:
for path in paths:
    # Parsh the gzipped FASTQ file
    pass
Get Sample Name from Path

When looping over the paths, you will need to get the sample name from the path.

To do that, you will need to remove the directory name, and the .fq.gz extension. You can use the pathlib.Path class again. Check out those docs and see if you can figure it out. Here is a hint:

# Extract parts of a path
path.stem  # filename without extension
path.suffix  # file extension

Note: If you have multiple extensions, like we do in these files (BAY_C1.fq.gz), you will need to remove them both: path.stem will only remove the .gz from the example file.

In the lib.py file, create a function called sample_id() that takes a Path and returns the name of the sample. E.g., if you had a path like this Path("reads/BAY_C1.fq.gz"), this function would return BAY_C1.

Parsing gzipped FASTQ Files

For working with gzip compressed FASTQ files, you’ll need to use Python’s gzip module. Something like this:

# "rt" mode for text reading
with gzip.open(path, "rt") as file:
    for record in SeqIO.parse(file, "fastq"):
        # process each record
Converting SeqRecord to ReadInfo

For each SeqRecord that you get with SeqIO.parse(), you need to convert it into a ReadInfo named tuple.

  • In the lib.py file, create a named tuple called ReadInfo with the following fields:
    • SampleID: The unique identifier for the sample from which the read originated
    • QualityScore: The mean quality score of the read
    • GC: The GC percent of the read
  • Next, in the lib.py file create a function called make_read_info that takes a sample name and a SeqRecord and returns a ReadInfo
    • This will require you to write some additional helper functions:
      • def quality_score(seq_record): Get the quality scores from a SeqRecord
      • def mean_quality_score(seq_record): Calculate the mean quality score for a SeqRecord
      • def gc_percent(seq_record): Calculate the GC percent for a SeqRecord
    • I know you could write this function without those helpers, but this is my assignment, and I say you have to write the helpers! ()

Part 1B: Parse Metadata and Merge with Read Data

  • Parse the metadata.tsv file and merge the metadata with the read quality information.
  • You can use pandas.read_csv() for this, but you will have to check out the docs to figure out how to change the delimiter.

Part 1C: Quality Distributions by Variable

  • Generate KDE distribution plots using seaborn.displot() for all combinations of read property (Quality Score and GC%) and sample variable (Batch, Location, Condition). The arguments should be like this:
    • x-axis: Read property (Quality Score and GC%)
    • y-axis: Sample variable (Batch, Location, Condition)
    • fill: true
    • height: 2
    • aspect: 2
  • Then, use the plots to answer the following questions:
    • Which variable is most closely identified with differences in Quality Score?
    • Which variable is most closely identified with differences in GC Content?
Details & Hints

To create multiple plots with different variables, you can either write each combination out by hand, or you can use a for loop like this:

# Example of creating plots in a loop
for read_property in ["QualityScore", "GC"]:
    for variable in ["Batch", "Location", "Condition"]:
        # Your plot code here...

Part 1D: Quality Scores and GC Content for Individual Samples

  • Generate box plots with seaborn.catplot() for Quality Score and GC Content. Use these arguments:
    • x-axis: Read property (quality score, GC)
    • y-axis: SampleID
    • fill: true
  • Set the hue for each plot to the variable that best explains the differences in each read property. (You identified the variables in Part 1C.)
  • Which sample has the lowest average quality scores?

Part 1E: Read Counts

  • Create a data frame with the number of reads for each sample (hint: you could use value_counts() for this)
  • Merge the metadata data frame and the read counts data frame
  • Generate read count bar plots for each sample with seaborn.catplot(). Use these arguments:
    • x-axis: Read Count
    • y-axis: SampleID
    • fill: true
  • Examine the plot to determine which variable is most closely associated with differences in read count across samples
  • Redo the the previous bar plot, but this time set the hue to the variable you identified in the previous step
  • Determine if there is a significant difference in read lengths for that variable using ANOVA (use the one from statsmodels this time)
  • If there is a significant difference run Tukey’s HSD and plot the test results results (use the one from statsmodels)
Details & Hints

For analyzing read count differences:

# ANOVA
formula = ...
model = ols(formula, data=...).fit()
anova_result = sm.stats.anova_lm(model, typ=2)

# Tukey's HSD
result = sm.stats.multicomp.pairwise_tukeyhsd(
    ...,
    groups=...,
)
_ = result.plot_simultaneous()

Part 2: Per-Base Quality Analysis (Optional)

Note: This part is completly optional! You will not be penalized for not attempting it. I suggest you do give it a try though, since we will be making a similar plot to the ones you will have seen in the output of the FastQC in your Systems Biology class.

In this part, you’ll examine quality score distributions at each nucleotide position. Here are the steps:

  1. Select a subset of samples representing different conditions (use these ["CHR_C1.fq.gz", "NEM_C2.fq.gz", "JEF_C1.fq.gz", "BAY_C3.fq.gz"])
  2. For each sample, extract quality scores at each base position for each read
  3. Create box plots to visualize how quality varies along the length of reads

This might seem a bit tricky, so let’s go over the details. Check out this pseudocode:

paths := join the "reads" directory with the four FASTQ files

# Process each FASTQ file
for each path in paths:
    sample_id := get the sample ID from the path

    # Create a list to hold quality scores from all reads in this file
    quality_scores := empty list

    #  Open and read the compressed FASTQ file
    open the gzipped file for text-reading:
        # Extract quality scores from each read
        for each read in the file:
            read_qualities := get per-base quality scores from read

            append read_qualities to quality_scores

    # Convert list of quality score lists to numpy matrix
    quality_matrix := convert quality_scores to numpy matrix

    # Convert numpy matrix to pandas data frame
    quality_df := convert quality_matrix to pandas data frame

    # Generate box plot
    create box plot using quality_df showing quality distribution by position

To join paths, you can use pathlib’s joinpath():

paths = [
    Path("...whatever directory name...").joinpath(path) for path in [..., ..., ...]
]

Here is some code to help you get started that converts the list of lists to a numpy matrix, then converts that to the pandas data frame:

# Convert list of lists to matrix
quality_data = np.matrix(quality_scores)

# Column names should run from 1 to the length of the reads.
# You could use `np.arange()` for this.
column_names = ...

# Convert to DataFrame and reshape
per_base_quality_scores = (
    pd.DataFrame(quality_data, columns=...)
    .melt(
        var_name=...,
        value_name=...,
    )
    .assign(SampleID=sample)
)

Here is some code to help you generate the plot:

# Then make a per-base quality score plot. It has a box plot of score
# distributions for each base in the set of reads.
sns.catplot(
    per_base_quality_scores,
    kind=...,
    x=...,
    y=...,
    showfliers=False,
    aspect=2,
).set(
    ylim=(0, None),
    title=...,
    ylabel=...,
    xticks=range(4, 100, 5),
)

Make sure that the title includes the sample ID (e.g., “XYZ_T1 Per-Base Quality Score” or something similar).

Part 3: Quality Filtering (Required)

In this section, you’ll implement a read filtering strategy. For each FASTQ file, you will have to:

  • Get the sample name
  • Get the name of the output file
  • Track the total number of reads
  • Track the number of “good” reads
  • Check for primer sequences at the start of the reads
    • If a read starts with one of the two primer sequences, remove that primer sequence from the start of the read
    • PRIMER_1 = "GGTTGTTTCCGCCCAGAGCT"
    • PRIMER_2 = "CTTTCTAATGGGCTT"
  • Check if a read is of good or bad quality
    • If it is good, it will be written to the output file
    • If it is bad, it won’t be written to the output file
  • Report the number and percentage of reads that passed filtering for each sample

Here is some more pseudocode to get you started:

paths := xyz

PRIMER_1 := GGTTGTTTCCGCCCAGAGCT
PRIMER_2 := CTTTCTAATGGGCTT

for each path in paths:
    sample := get the name of the sample from the path
    outfile_name := get the name of the outfile from the path

    total_reads := 0
    printed_reads := 0

    open the gzipped file for text-reading, and the outfile for writing:
        for each record in the parsed FASTQ file:
            total_reads := total_reads + 1
            record := record with any primers removed

            if the read is good quality:
                printed_reads := printed_reads + 1
                write the FASTQ formated record to the outfile

    print the sample_id, total_reads, printed_reads, and percent_printed

Details & Hints

Note: There is a similar example in the biopython cookbook called Simple quality filtering for FASTQ files that you may want to check out as well!

FASTQ Paths

Use the path.glob like in part 1 to get all the Paths.

Filtered Outfile Name

This is a bit fiddly, so here is some starter code:

def filtered_outfile_name(path):
    directory = path.resolve().parent

    # Strip off the .fq.gz
    sample_name = ...

    outfile_name = f"{sample_name}.filtered.fq"

    return directory.joinpath(outfile_name)

You will find this function already in lib.py. You will need to complete it before using it.

Opening Multiple Files

Use multiple context managers in one with statement when you need to open both input and output files simultaneously:

with gzip.open(input_path, "rt") as infile, open(output_path, "w") as outfile:
    # Process files
Removing Primer Sequences

Yoyu will implement a simple function to remove primer sequences. There are two possible primer sequences in the reads:

PRIMER_1 = "GGTTGTTTCCGCCCAGAGCT"
PRIMER_2 = "CTTTCTAATGGGCTT"
  • Not all reads will have primer sequences
  • If a read has a primer sequence, it will only ever be at the start of the read
  • A read will have either 0 or 1 primer sequences (in other words: both primers will never be found in the same read)

Write a function called maybe_strip_primer in lib.py that takes a SeqRecord and a list of primer sequences. This function should return a SeqRecord with any primer sequences removed, and if no primer sequence is present, the original SeqRecord should be returned.

Note: You can remove reads and quality scores from the beginning of a SeqRecord using the normal string slicing notation. See the biopython cookbook for details.

Note: If you remember learning about Illumina sequencing in your other classes, you might think this “primer trimming” is a bit weird. Just roll with it!

Checking Read Quality

For this project, a read is considered low quality if it has 25 or more bases whose Phred quality score is strictly less than 25.

In the lib.py file, write a function called is_quality_good that takes a SeqRecord and returns a boolean indicating whether the sequence is good quality or not. (Use the quality_scores function you defined in Part 1 to help you out.)

Requirements

Your completed miniproject should include:

  1. A Quarto notebook (miniproject_3_solution.qmd) with:
    1. Code for all three parts of the analysis
    2. Visualizations, interpretations, and discussions of your findings
    3. Comments explaining your approach
  2. A Python module (lib.py) containing helper functions

Follow all the guidelines mentioned above when writing those files!

The directory structure you should have at the end of the project should look something like this:

miniproject_3_ryan_moore/
├── lib.py
├── metadata.tsv
├── miniproject_3_instructions.qmd
├── miniproject_3_solution.qmd
└── reads
    ├── BAY_C1.filtered.fq
    ├── BAY_C1.fq.gz
    ├── BAY_C2.filtered.fq
    ├── BAY_C2.fq.gz
    ├── ... (more read files)

You will need to zip (or tar) that directory and upload the resulting zipped (or tar) file. (You can use zip or tar, whichever you’re most comfortable with.)

Please don’t make additional changes to this structure! You will need to leave the structure as is for me to be able to run your code. If you do not keep the structure as is, and if you do not adjust the top level directory with your name, I will return your project to you without additional comments until you correct it.

Also, remember that this is a miniproject, so you should be engaging meaningfully with the material and trying to discuss the results you find. Simply writing code with no exposition will not satisfy the requirements for the miniproject!

Good luck with your final miniproject!

Note: please let me know if you find any errors in this document!